Frame-aware transcription and translation.
Last Updated: 30 Mar 2026
Length: 39 bases
mRNA: AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG
Amino acids: MAIVMGR*KGAR*
Codons: AUG(M)GCC(A)AUU(I)GUA(V)AUG(M)GGC(G)CGC(R)UGA(*)AAG(K)GGU(G)GCC(A)CGA(R)UAG(*)
DNA → RNA → Protein Translator helps you frame-aware transcription and translation. It is commonly used by domain specialists, operations teams, learners for dna to protein, mrna translator, codon translation.
DNA → RNA → Protein Translator
Frame-aware transcription and translation.
- Runs entirely in your browser.
- For planning and education; verify critical decisions with qualified professionals.
Disclaimer: Specialty calculators provide rough estimates for planning and education, not professional engineering, tax, or legal advice.