DNA → RNA → Protein

Frame-aware transcription and translation.

Last Updated: 30 Mar 2026

Length: 39 bases

mRNA: AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG

Amino acids: MAIVMGR*KGAR*

Codons: AUG(M)GCC(A)AUU(I)GUA(V)AUG(M)GGC(G)CGC(R)UGA(*)AAG(K)GGU(G)GCC(A)CGA(R)UAG(*)

DNA → RNA → Protein Translator helps you frame-aware transcription and translation. It is commonly used by domain specialists, operations teams, learners for dna to protein, mrna translator, codon translation.

DNA → RNA → Protein Translator

Frame-aware transcription and translation.

  • Runs entirely in your browser.
  • For planning and education; verify critical decisions with qualified professionals.

Disclaimer: Specialty calculators provide rough estimates for planning and education, not professional engineering, tax, or legal advice.

Frequently Asked Questions